View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2947-Insertion-4 (Length: 292)
Name: NF2947-Insertion-4
Description: NF2947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2947-Insertion-4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 7 - 292
Target Start/End: Original strand, 25610658 - 25610943
Alignment:
| Q |
7 |
aagaagaagttactgcagcagctccattaaccgtgggcaagagaaagaggggcagaccaagaaaagttccttctcctgagagtgagtgctttaagaaaga |
106 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25610658 |
aagaagaagttactgcagcacctccattcaccgtggccaagagaaagaggggcagaccaagaaaagttccttctcctgagagtgagtgctttaagaaaga |
25610757 |
T |
|
| Q |
107 |
aaaagctgaagttccagcaaaaattgcggttaagagaaatgatggtagagcaagaaaaagtcctgctggtgagagagtatgcttcaggaaaaaagaagaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25610758 |
aaaagctgaagttccagcaaaaattgcggttaagagaaatgattgtagagcaagaaaaagtcctgctggtgagagagtatgcttcaggaaaaaagaagaa |
25610857 |
T |
|
| Q |
207 |
gttgcaccaacaatcatgtctatggggaaaccaagaaaaaatcgtcagagagtaagcgtaaagaaagaagaagccaaagctgcagc |
292 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25610858 |
gttgcagcaacaatcatgtctatggggaaacgaagaaaaaatcgtcagagagtaagcgtaaagaaagaagaagccaaagctgcagc |
25610943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9555 times since January 2019
Visitors: 7930