View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2947-Insertion-5 (Length: 211)
Name: NF2947-Insertion-5
Description: NF2947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2947-Insertion-5 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 8 - 208
Target Start/End: Original strand, 42222995 - 42223191
Alignment:
Q |
8 |
attgcgcaggtgaacgtttaagcccttgggtggccgctggatgttttacaatgggcatatcaattctattcttctgaaccttactctgacttgaaatggt |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
42222995 |
attgcgcaggtgaacgtttaagcccttgggtggccgttggatgttttacaatgggcgtatcaattctattcttctgaaccttactctgacttgaaatgtt |
42223094 |
T |
|
Q |
108 |
tccattttcctttccattcttttcacttgattgatattcaatttgttggttattattctctgtgtaaggggctttttggaatgtaaattttttcccaccc |
207 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42223095 |
tccattttcctttccattcttttcac----ttgatattcaatttgttggttattattctctgtgtaaggggctttttggaatgtaaattttttcccaccc |
42223190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8461 times since January 2019
Visitors: 7803