View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2947-Insertion-8 (Length: 190)
Name: NF2947-Insertion-8
Description: NF2947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2947-Insertion-8 |
| |
|
[»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 9e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 9e-72
Query Start/End: Original strand, 7 - 190
Target Start/End: Original strand, 27684722 - 27684903
Alignment:
Q |
7 |
atctccgtcgtttattaattttaaataataaatcaatgnnnnnnnnnngatagtacttctattatcaccttctttaatttcaaagaaaattatatatatt |
106 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
27684722 |
atctccatcgtttattaattttaaataataaatcaatgaaaaaaaa--gatagtacttctattatcaccttctttaatttcaaagaaaatgatatatatt |
27684819 |
T |
|
Q |
107 |
ttttcaaagaaaatgatattattggtttacttccatttcatcctacaatgttaatcattcgtgcatacactgtagtattaccta |
190 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
27684820 |
ttttcaaagaaaatgatattattggtttacttccatttcatcctacaatgtcaatcattcgtgcatacactgtagtattaccta |
27684903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8333 times since January 2019
Visitors: 7802