View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2947_high_10 (Length: 236)
Name: NF2947_high_10
Description: NF2947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2947_high_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 27 - 221
Target Start/End: Original strand, 1964207 - 1964401
Alignment:
| Q |
27 |
acatctcataggtactactaatcatactcactaaaatttcatgaagttttattcaaaatgtgttttgtagccgcaaaacagttgtttgatattcaaccaa |
126 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1964207 |
acatctcatagatactactaatcatactccctaaaatttcatcaagttttattcaaaatatgttttgtagccgcaaaacagttgtttgatattcaaccaa |
1964306 |
T |
|
| Q |
127 |
aaaggctccaatagaaatctaaatttctaataaagttcttattggattcaccttcaaagtgtttcacgcggttgcggatgacaaagtgaaaaatg |
221 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1964307 |
aaaggctccaagagaaatctaaatttctaataaagttcttattggattcaccttcaaagtgtttcacgcggttgcggatgccaaagtgaaaaatg |
1964401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14696 times since January 2019
Visitors: 8422