View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2947_high_12 (Length: 219)

Name: NF2947_high_12
Description: NF2947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2947_high_12
NF2947_high_12
[»] chr8 (2 HSPs)
chr8 (135-205)||(7701280-7701350)
chr8 (18-66)||(7701120-7701168)


Alignment Details
Target: chr8 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 135 - 205
Target Start/End: Original strand, 7701280 - 7701350
Alignment:
135 aataatgaaatttcattaagcaagcacaccggtagaattcacaccaaatgaatcattatagatgaaaatat 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
7701280 aataatgaaatttcattaagcaagcacaccggtagaattcacaccaaatgaatcattatagatgagaatat 7701350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 7701120 - 7701168
Alignment:
18 aacatatttcaccctgatttttatcattatagttgtttcttgagacata 66  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
7701120 aacatatttcaccctgatttttatcattatagttgtttcttgagacata 7701168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 12704 times since January 2019
Visitors: 8224