View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2947_high_12 (Length: 219)
Name: NF2947_high_12
Description: NF2947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2947_high_12 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 135 - 205
Target Start/End: Original strand, 7701280 - 7701350
Alignment:
Q |
135 |
aataatgaaatttcattaagcaagcacaccggtagaattcacaccaaatgaatcattatagatgaaaatat |
205 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
7701280 |
aataatgaaatttcattaagcaagcacaccggtagaattcacaccaaatgaatcattatagatgagaatat |
7701350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 7701120 - 7701168
Alignment:
Q |
18 |
aacatatttcaccctgatttttatcattatagttgtttcttgagacata |
66 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7701120 |
aacatatttcaccctgatttttatcattatagttgtttcttgagacata |
7701168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12704 times since January 2019
Visitors: 8224