View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2994-Insertion-19 (Length: 193)
Name: NF2994-Insertion-19
Description: NF2994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2994-Insertion-19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 4e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 4e-52
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 29967627 - 29967738
Alignment:
| Q |
8 |
atgacttgcaaacgaggcagagtttggcagcatgtttagggcttaatagtcttgtgattttgaggagtatttcaggagggagtgagtcaaataaacccaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29967627 |
atgacttgcaaacgaggcagagtttggcagcatgtttagggcctaatagtcttgtgattttgaggagtatgtcaggagggagtgagtcaaataaacccaa |
29967726 |
T |
|
| Q |
108 |
aggactcggagc |
119 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29967727 |
aggactcggagc |
29967738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 18114 times since January 2019
Visitors: 3794