View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2994-Insertion-20 (Length: 156)
Name: NF2994-Insertion-20
Description: NF2994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2994-Insertion-20 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 10 - 156
Target Start/End: Original strand, 3225142 - 3225288
Alignment:
| Q |
10 |
gaaaacaaactcaaccaatgagccataaaaaccagggatttgaagataattctgatcataagtttgagaattaaaaggaaactttgatctctcaataaga |
109 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3225142 |
gaaaacaaactcaaccaatgagccacaaaaaccagggatttgaagataattctgatcataagtttgagaattaaaaggaaactttgatctctcaataaga |
3225241 |
T |
|
| Q |
110 |
ccaaaaacaattgtatcttcttgtctaaccaaagtctccctcactgt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3225242 |
ccaaaaacaattgtatcttcttgtctaaccaaagtctccctcactgt |
3225288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16893 times since January 2019
Visitors: 3777