View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2994-Insertion-21 (Length: 115)
Name: NF2994-Insertion-21
Description: NF2994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2994-Insertion-21 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 2e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 2e-52
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 40432558 - 40432451
Alignment:
| Q |
8 |
gtaatggacaacatgactagatttagtcgtaggatgattaattttccttctttgatgttaagcatatctattgctaattgttttttgataataggtcttt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40432558 |
gtaatggacaacatgactagatttagtcgtaggatgattaattttccttctttgatgttaagcatatctattgctaattgtgttttgataataggtcttt |
40432459 |
T |
|
| Q |
108 |
gcatccca |
115 |
Q |
| |
|
|||||||| |
|
|
| T |
40432458 |
gcatccca |
40432451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 239 times since January 2019
Visitors: 3986