View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2994-Insertion-23 (Length: 95)

Name: NF2994-Insertion-23
Description: NF2994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2994-Insertion-23
NF2994-Insertion-23
[»] chr8 (1 HSPs)
chr8 (7-95)||(2352151-2352239)
[»] chr4 (1 HSPs)
chr4 (22-95)||(38916769-38916842)
[»] chr3 (1 HSPs)
chr3 (22-95)||(31528004-31528077)


Alignment Details
Target: chr8 (Bit Score: 89; Significance: 2e-43; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 7 - 95
Target Start/End: Original strand, 2352151 - 2352239
Alignment:
7 atttaaaatgttcaaaagttgatcccttacgtaaccgatgtcagcaaaagttcatcatttccgtcaaattttgagttaactctgtctaa 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2352151 atttaaaatgttcaaaagttgatcccttacgtaaccgatgtcagcaaaagttcatcatttccgtcaaattttgagttaactctgtctaa 2352239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 46; Significance: 8e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 46; E-Value: 8e-18
Query Start/End: Original strand, 22 - 95
Target Start/End: Original strand, 38916769 - 38916842
Alignment:
22 aagttgatcccttacgtaaccgatgtcagcaaaagttcatcatttccgtcaaattttgagttaactctgtctaa 95  Q
    ||||||||| ||||||| || ||||||| || ||||||||| ||||||||||||||||||||||||||| ||||    
38916769 aagttgatctcttacgtcactgatgtcaacataagttcatcctttccgtcaaattttgagttaactctgcctaa 38916842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 38; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.0000000000005
Query Start/End: Original strand, 22 - 95
Target Start/End: Original strand, 31528004 - 31528077
Alignment:
22 aagttgatcccttacgtaaccgatgtcagcaaaagttcatcatttccgtcaaattttgagttaactctgtctaa 95  Q
    |||||| | |||||| | || ||||||| || || ||||||||||||||||||||||||||||||| |||||||    
31528004 aagttggttccttacattactgatgtcaacataaattcatcatttccgtcaaattttgagttaactgtgtctaa 31528077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 17715 times since January 2019
Visitors: 3783