View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2994-Insertion-9 (Length: 375)
Name: NF2994-Insertion-9
Description: NF2994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2994-Insertion-9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 7e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 218 - 369
Target Start/End: Complemental strand, 31054271 - 31054120
Alignment:
| Q |
218 |
atttttggtagaaactttacataatgctgtattggactcatagtgttgcgcattctgcataaaaatacatcctattttaataaatacatacgaagaaaaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31054271 |
atttttggtagaaactttacataatgatgtattggactcatagtgttgcgcattctgcataaaaatacatcctattttaataaatacatacgacgaaaaa |
31054172 |
T |
|
| Q |
318 |
gccatttcagaacacaaatgttttgaaacacgacagctcaaaaacaacaaag |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
31054171 |
gccatttcagaacacaaatgttttgaaacacaacaactcaaaaacaacaaag |
31054120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 8 - 130
Target Start/End: Complemental strand, 31055668 - 31055546
Alignment:
| Q |
8 |
caaatggcactataatatattaaaaggtagtcatattttgtattctgcaagtttataatgaaaaagacgtgttagaccgtttttcttggtttcaattatc |
107 |
Q |
| |
|
|||||| ||| ||||| | ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31055668 |
caaatgacaccataatgttttaaaaggtagccatattttgtattctgcaagtttataatgaaaaagacgtgttagaccgtttttcttggtttcaattatc |
31055569 |
T |
|
| Q |
108 |
tgcattaggctcaattttcttaa |
130 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
31055568 |
tgcattaagctcaattttcttaa |
31055546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 218 - 287
Target Start/End: Original strand, 53451590 - 53451659
Alignment:
| Q |
218 |
atttttggtagaaactttacataatgctgtattggactcatagtgttgcgcattctgcataaaaatacat |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53451590 |
atttttggtagaaactttacataatgctgtattggactcaaagtgttgcgcattctgcataaaaatacat |
53451659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 131 - 176
Target Start/End: Original strand, 53451477 - 53451522
Alignment:
| Q |
131 |
gagaaagaagagaagtgggtgaagcaaacaaatatacagacacata |
176 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||| | ||||||||| |
|
|
| T |
53451477 |
gagaaagaagagcagtgggagaagcaaacaaatacatagacacata |
53451522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16591 times since January 2019
Visitors: 3770