View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2994_high_10 (Length: 359)
Name: NF2994_high_10
Description: NF2994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2994_high_10 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 109 - 345
Target Start/End: Original strand, 41824943 - 41825179
Alignment:
Q |
109 |
ccgtcaccgcttcattgttttcacaagcttgaactatataagcagcatactagtatatcagtgtagtaccaaaatcaaagaaaaacaacgaaagtgtgtg |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41824943 |
ccgtcaccgcttcattgttttcacaagcttgaactatataagcagcatactagtatatcagtgtagtaccaaaatcaaagaaaaacaacgaaagtgtgtg |
41825042 |
T |
|
Q |
209 |
tcaggttcacaccattcaccatgtcattatcaaaatcaaaagctctattcttcatctttaaaatattgatgttgaatttcataacaccaatgatacatgc |
308 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41825043 |
tcaggttcacaccattcaccatgtcattatcaaaatcaaaagctctattcttcatctttaaaatattgatgttgaatttcataacaccaatgatacatgc |
41825142 |
T |
|
Q |
309 |
atgtggtccatgcactcagccaaatccaccaccttac |
345 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
41825143 |
atgtggtccatgcactcagccaaatccaccaccttac |
41825179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16889 times since January 2019
Visitors: 3777