View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2994_high_24 (Length: 236)
Name: NF2994_high_24
Description: NF2994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2994_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 45033387 - 45033606
Alignment:
| Q |
1 |
ccaccatctaattttttctaaaattgatcacaaaattatagtaagtataaactgctaaacatagattaaaccagaatcatacgaaataagagaaatatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45033387 |
ccaccatctaattttttctaaaattgatcacaaaattatagtaagtataaactgctaaacatagtttaaaccagaatcatacgaaataagagaaatatgt |
45033486 |
T |
|
| Q |
101 |
tataaccttagcagtaaaaataagcatccaggttctcccaggggattcctttcctccaagagtgtcaagaaaagcagaaggatcaatttttgctttctca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45033487 |
tataaccttagcagtaaaaataagcatccaggttctcccaggggattcctttcctccaagagtgtcaagaaaagcagaaggatcaatttttgctttctca |
45033586 |
T |
|
| Q |
201 |
atgagagaaagtgctgaaag |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45033587 |
atgagagaaagtgctgaaag |
45033606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 18847 times since January 2019
Visitors: 3804