View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2994_low_17 (Length: 284)
Name: NF2994_low_17
Description: NF2994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2994_low_17 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 4e-50; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 14 - 126
Target Start/End: Original strand, 30714978 - 30715090
Alignment:
Q |
14 |
aaaattagttaaaggagaaaaacataaataaatctctcgtgttaataccatgggaactccaacgctgatttctactactaagccatatcaacaaatttga |
113 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
30714978 |
aaaattagttaaaggagaaaaacataaataaatctctcgtgttaataccatgggaactccaacgctgatttctactactcagccatatcaacaaatttga |
30715077 |
T |
|
Q |
114 |
attatctaccacg |
126 |
Q |
|
|
||| | ||||||| |
|
|
T |
30715078 |
attttgtaccacg |
30715090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 171 - 265
Target Start/End: Original strand, 30715135 - 30715231
Alignment:
Q |
171 |
gagcctcgaaatttggtaggtccaactct--agaattgtttgcatccttaaaaaacggctctggtttcacaaatgcatagttgctctcatctttgtt |
265 |
Q |
|
|
|||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
30715135 |
gagcctcgaaattttgtaggtccaactctgtagaattgtttgcatccttaaaaaccggctctggtttcacaaatgcatagttgctctcatgtttgtt |
30715231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 8 - 126
Target Start/End: Original strand, 30733326 - 30733440
Alignment:
Q |
8 |
tcgaagaaaattagttaaaggagaaaaacataaataaatctctcgtgttaataccatgggaactccaacgctgatttctactactaagccatatcaacaa |
107 |
Q |
|
|
||||| ||||||| ||||| ||||||||||||||| ||| | |||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
T |
30733326 |
tcgaaaaaaattatttaaaagagaaaaacataaat----ctcgcatgttaataccatgggaactccaacgctgatttctaccactcggccatatcaacaa |
30733421 |
T |
|
Q |
108 |
atttgaattatctaccacg |
126 |
Q |
|
|
||||||||| ||||||||| |
|
|
T |
30733422 |
atttgaattttctaccacg |
30733440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 173 - 258
Target Start/End: Original strand, 30733487 - 30733575
Alignment:
Q |
173 |
gcctcgaaatttggtaggtccaactcta--gaattgtttgcatcct-taaaaaacggctctggtttcacaaatgcatagttgctctcat |
258 |
Q |
|
|
||||| |||||| |||| |||||||||| || ||||||||| ||| |||||| || || ||||||| ||| ||||||||||||||||| |
|
|
T |
30733487 |
gcctcaaaattttgtagatccaactctatagagttgtttgcaccctctaaaaatcgactatggtttctcaagtgcatagttgctctcat |
30733575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 19403 times since January 2019
Visitors: 3809