View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2994_low_20 (Length: 271)

Name: NF2994_low_20
Description: NF2994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2994_low_20
NF2994_low_20
[»] chr4 (1 HSPs)
chr4 (20-262)||(5075459-5075701)
[»] chr6 (1 HSPs)
chr6 (152-222)||(27583930-27584000)


Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 20 - 262
Target Start/End: Complemental strand, 5075701 - 5075459
Alignment:
20 agcaaacccctctatggactgctcaaacaaagggaatgttggcatatggagaattagaacctcaaacctaaagaggagcaaacacctagatctcaagctt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
5075701 agcaaacccctctatggactgctcaaacaaagggaatgttggcatatggagaattagaacctcaaacctaaagaggagcaaacacctaggtctcaagctt 5075602  T
120 acaccaccaggtcaacccaacccatgcgggttacaaaccctaaatacttaattttgattcataatcccattaaatgcatcattagccctgacagtacaaa 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5075601 acaccaccaggtcaacccaacccatgcgggttacaaaccctaaatacttaattttgattcataatcccattaaatgcatcattagccctgacagtacaaa 5075502  T
220 attcacaccgccattcaatacactcaccaacagagacctatga 262  Q
    |||||||||||||||||||||||||||||||||||||||||||    
5075501 attcacaccgccattcaatacactcaccaacagagacctatga 5075459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 152 - 222
Target Start/End: Original strand, 27583930 - 27584000
Alignment:
152 acaaaccctaaatacttaattttgattcataatcccattaaatgcatcattagccctgacagtacaaaatt 222  Q
    |||||||||||||| ||||||  |||||| ||| ||||||||||||| ||||| |||||||| || |||||    
27583930 acaaaccctaaatagttaattaagattcaaaattccattaaatgcatgattaggcctgacagcaccaaatt 27584000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 18189 times since January 2019
Visitors: 3796