View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3141A-Insertion-17 (Length: 81)
Name: NF3141A-Insertion-17
Description: NF3141A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3141A-Insertion-17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 2e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 7 - 81
Target Start/End: Original strand, 24894030 - 24894104
Alignment:
| Q |
7 |
ataaaactcagctttaaatttttatgttgctcttggtccgttgaaaatttaaacatcaagtacatatctagctca |
81 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24894030 |
ataaaactcagctttaaatttttatggtgctcttggtccgttgaaaatttaaacatcaggtacatatctagctca |
24894104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10985 times since January 2019
Visitors: 8059