View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3141A-Insertion-19 (Length: 128)
Name: NF3141A-Insertion-19
Description: NF3141A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3141A-Insertion-19 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 12 - 128
Target Start/End: Complemental strand, 47427595 - 47427479
Alignment:
| Q |
12 |
atataatttcgcttctcatatcactctcagacttcctctcatacgtgttctctggcattcttcttcgccgtcaaagattgcaccacgcagtttcttgcaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47427595 |
atataatttcgcttctcatatcactctcagacttcctctcatacgtgttctctggcatttttcttcgccgtcaaagattgcaccacgcagtttcttgcaa |
47427496 |
T |
|
| Q |
112 |
atagcatctttctggta |
128 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
47427495 |
atagcatctttctggta |
47427479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13432 times since January 2019
Visitors: 8302