View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3141A-Insertion-20 (Length: 124)
Name: NF3141A-Insertion-20
Description: NF3141A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3141A-Insertion-20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 4e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 4e-45
Query Start/End: Original strand, 7 - 106
Target Start/End: Original strand, 50489064 - 50489163
Alignment:
| Q |
7 |
agagggtagcgggtgaagatggagggacgcgtttcaagagggcaccaacaacctcatcggcaaggaggcttccataaacaaaaacgttgtgattctgatt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50489064 |
agagggtagcgggtgaagatggagggacgcgtttcaagagggcacaaacaacctcatcggcaaggaggcttccataaacaaaaacgttgtgattgtgatt |
50489163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 93 - 124
Target Start/End: Original strand, 50489162 - 50489193
Alignment:
| Q |
93 |
ttgtgattctgattctgagtagtacccgctcc |
124 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |
|
|
| T |
50489162 |
ttgtgattctgattctgagtagtgcccgctcc |
50489193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10498 times since January 2019
Visitors: 7978