View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3210-1-Insertion-3 (Length: 363)
Name: NF3210-1-Insertion-3
Description: NF3210-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF3210-1-Insertion-3 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 9 - 254
Target Start/End: Complemental strand, 22251180 - 22250935
Alignment:
Q |
9 |
tgaagacctgcaaaataaaaacaatgagacaatagacatgtgaatgctaacaggcaagccgaagattcagaattgacagagaatatttatgtaacatgaa |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||| ||| |
|
|
T |
22251180 |
tgaagacctgcaaaataaaaacaatgagacaatagacatgtgaacgctaacaggcaagctgaagattcagaattgacagaaaatatttatgtaacaggaa |
22251081 |
T |
|
Q |
109 |
gtgtaacccagaaataattgacgttttaattttctcggttacactccttgttacataaatattctttgccagttctaaatattctttatgtatatttttc |
208 |
Q |
|
|
||||||| ||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22251080 |
gtgtaacttagaaataattgacgtgttaattttctcagttacactccttattacataaatattctttgccagttctaaatattctttatgtatattttta |
22250981 |
T |
|
Q |
209 |
tttttgcatgtgaggttttatcatcaaaaatttcagtgctgcttgt |
254 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22250980 |
tttttgcatgtgaggttttatcatcaaaaatttcagtgctgcttgt |
22250935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3387 times since January 2019
Visitors: 8687