View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3704-Insertion-10 (Length: 239)
Name: NF3704-Insertion-10
Description: NF3704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF3704-Insertion-10 |
| |
|
[»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 169 - 239
Target Start/End: Complemental strand, 53477413 - 53477343
Alignment:
Q |
169 |
cggtccattagagtttccttaatatttaaatacttcagttctagttatagagacaaatttttcattcaata |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
53477413 |
cggtccattagagtttccttaatatttaaatacttcagttctagttatagagataaatttttcattcaata |
53477343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 71
Target Start/End: Complemental strand, 53477560 - 53477497
Alignment:
Q |
8 |
agtttgactaggaaaagcatctaaaaagattgaaaccattaatatgttgtagaaacgaaaacac |
71 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53477560 |
agtttgactaggaaaagcatctaaaaagattgaaaccattaatatgttgtagaaacgaaaacac |
53477497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2929 times since January 2019
Visitors: 8641