View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3704-Insertion-9 (Length: 263)
Name: NF3704-Insertion-9
Description: NF3704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3704-Insertion-9 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 8 - 263
Target Start/End: Complemental strand, 34017556 - 34017301
Alignment:
| Q |
8 |
ctaacatcctcaaaatccatgaagtcatggctacaaaaaccaaaatccatcttattgttgaattcgccgccggtggtgagcttttctccgctctctcccg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34017556 |
ctaacatcctcaaaatccatgaagtcatggctacaaaaaccaaaatccatcttatcgttgaattcgccgccggtggtgagcttttctccgctctctcccg |
34017457 |
T |
|
| Q |
108 |
ccgtggaagattctccgaacccaccgctcgcttctactttcaacagcttgtctctgcgttacgtttctgccaccgtaatggcgtcgctcaccgtgatctt |
207 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34017456 |
ccgtggaagattctccgaatccaccgctcgtttctactttcaacagcttgtctctgcgttacgtttctgccaccgtaacggcgtcgctcaccgtgatctt |
34017357 |
T |
|
| Q |
208 |
aaaccgcagaatctcctcctcgacgccgatgggaacctcaaggtttctgatttcgg |
263 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
34017356 |
aaaccgcaaaatctcctcctcgacgccgatgggaatctcaaggtttccgatttcgg |
34017301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 142 - 263
Target Start/End: Complemental strand, 15171972 - 15171851
Alignment:
| Q |
142 |
tactttcaacagcttgtctctgcgttacgtttctgccaccgtaatggcgtcgctcaccgtgatcttaaaccgcagaatctcctcctcgacgccgatggga |
241 |
Q |
| |
|
||||||||||||||||| || || | |||||||||||||||| || |||||||||| ||||| ||||||||||||||||||||||| || || || | |
|
|
| T |
15171972 |
tactttcaacagcttgtttccgctctttgtttctgccaccgtaacggtatcgctcaccgcgatctcaaaccgcagaatctcctcctcgatgctgaaggta |
15171873 |
T |
|
| Q |
242 |
acctcaaggtttctgatttcgg |
263 |
Q |
| |
|
| ||||||||||| |||||||| |
|
|
| T |
15171872 |
atctcaaggtttccgatttcgg |
15171851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2941 times since January 2019
Visitors: 8641