View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4350-Insertion-7 (Length: 81)
Name: NF4350-Insertion-7
Description: NF4350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4350-Insertion-7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 8e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 8e-33
Query Start/End: Original strand, 7 - 81
Target Start/End: Original strand, 36487594 - 36487668
Alignment:
| Q |
7 |
agttatttgaattcatggtcttaatctaaaacttcaattttatttgaattcattgagactatacttccagcgtga |
81 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36487594 |
agttatttgaattcatgttcttaatctaaaacttcaattttatttgaattcattgagactatacttccagcgtga |
36487668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 7 - 49
Target Start/End: Complemental strand, 18883570 - 18883528
Alignment:
| Q |
7 |
agttatttgaattcatggtcttaatctaaaacttcaattttat |
49 |
Q |
| |
|
|||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
18883570 |
agttgtttgaattcacgttcttaatctaaaacttcaattttat |
18883528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 647 times since January 2019
Visitors: 8213