View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4350_high_3 (Length: 326)
Name: NF4350_high_3
Description: NF4350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4350_high_3 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 136 - 317
Target Start/End: Original strand, 46417768 - 46417946
Alignment:
Q |
136 |
atcttaggatccatatacatgacaactaacagtattagatgatacgcagaaaaaaggcataaccccatctaatccggaatatccggcgattgcaagtggc |
235 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
46417768 |
atcttaggatccatatacatgacaactaacagtattagatga---gcagaaaaaaggcataaccccatctaatccggaatatccggggattgcaagtggc |
46417864 |
T |
|
Q |
236 |
taagagatgttaggcagattccaattacgagggatgcatgaaagtgtaacaacttaccataccagttacctaagagaataat |
317 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46417865 |
taagagatgttaggcagattccaattacgagggatgcatgaaagtgtaacaacttaccataccagttacctaagagaataat |
46417946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 46417692 - 46417769
Alignment:
Q |
18 |
gttcactgaatataaatgatagatagaggctaagtgcagccagcaaatttacttcatattcaccctccattttgggat |
95 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
46417692 |
gttcactgaatataaatgatagatagaggctaagtgcagccagtaaatttacttcatattcaccctccattttgggat |
46417769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1357 times since January 2019
Visitors: 8475