View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4350_low_8 (Length: 223)

Name: NF4350_low_8
Description: NF4350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4350_low_8
NF4350_low_8
[»] chr1 (2 HSPs)
chr1 (1-204)||(40514517-40514720)
chr1 (119-189)||(40509283-40509350)


Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 40514517 - 40514720
Alignment:
1 tatgtctttctacaaactggacatgtcaacttcattatcaaccaaggatcaacacaagcaacatgaaacaaatgaccacaaccaggaagcattctcaaca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
40514517 tatgtctttctacaaactggacatgtcaacttcattatcaaccaaggatcaacacaagcaacatgaaacaaatgaccacaactaggaagcattctcaaca 40514616  T
101 aatcagattctttataatccatcaaacatattgagcagcaacaactactaattgaattaatattattgctgttacataatttcacttcagataaatatgg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40514617 aatcagattctttataatccatcaaacatattgagcagcaacaactactaattgaattaatattattgctgttacataatttcacttcagataaatatgg 40514716  T
201 tata 204  Q
    ||||    
40514717 tata 40514720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 189
Target Start/End: Original strand, 40509283 - 40509350
Alignment:
119 ccatcaaacatattgagcagcaacaactactaattgaattaatattattgctgttacataatttcacttca 189  Q
    ||||||| |||||  ||||||||||||||||   |||||||||| ||||||||||||| ||||| ||||||    
40509283 ccatcaagcatatgaagcagcaacaactact---tgaattaatactattgctgttacacaatttgacttca 40509350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 344 times since January 2019
Visitors: 8104