View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4350_low_8 (Length: 223)
Name: NF4350_low_8
Description: NF4350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4350_low_8 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 40514517 - 40514720
Alignment:
Q |
1 |
tatgtctttctacaaactggacatgtcaacttcattatcaaccaaggatcaacacaagcaacatgaaacaaatgaccacaaccaggaagcattctcaaca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
40514517 |
tatgtctttctacaaactggacatgtcaacttcattatcaaccaaggatcaacacaagcaacatgaaacaaatgaccacaactaggaagcattctcaaca |
40514616 |
T |
|
Q |
101 |
aatcagattctttataatccatcaaacatattgagcagcaacaactactaattgaattaatattattgctgttacataatttcacttcagataaatatgg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40514617 |
aatcagattctttataatccatcaaacatattgagcagcaacaactactaattgaattaatattattgctgttacataatttcacttcagataaatatgg |
40514716 |
T |
|
Q |
201 |
tata |
204 |
Q |
|
|
|||| |
|
|
T |
40514717 |
tata |
40514720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 189
Target Start/End: Original strand, 40509283 - 40509350
Alignment:
Q |
119 |
ccatcaaacatattgagcagcaacaactactaattgaattaatattattgctgttacataatttcacttca |
189 |
Q |
|
|
||||||| ||||| |||||||||||||||| |||||||||| ||||||||||||| ||||| |||||| |
|
|
T |
40509283 |
ccatcaagcatatgaagcagcaacaactact---tgaattaatactattgctgttacacaatttgacttca |
40509350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 344 times since January 2019
Visitors: 8104