View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4356-Insertion-10 (Length: 388)
Name: NF4356-Insertion-10
Description: NF4356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4356-Insertion-10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 8 - 388
Target Start/End: Complemental strand, 38997441 - 38997060
Alignment:
| Q |
8 |
ccaacaactttatcacaataggaaaggcctgaaggagccacagttaattgacatggaactgcttcagctgctgttgcagtgggtattattggttgcaata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38997441 |
ccaacaactttatcacaataggaaaggcctgaaggagccacagttaattgacatggaactgcttcagcagctgttgcagtgggtattattggttgcaata |
38997342 |
T |
|
| Q |
108 |
aagaatgtagaagaccaaaactcaaggagaggcctattgcttctcttcttttcaattgattatccttttgtacaagaactggtggttgttgttggacttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38997341 |
aagaatgtagaagaccaaaactcaaggagaggcctattgcttctcttcttttcaattgattatccttttgtacaagaactggtggttgttgttggacttg |
38997242 |
T |
|
| Q |
208 |
gacagaacatgttgttgttagtgaattcaaatggttaagtttttggggctgcaaggaggtgaggcaagtcccaacagaatatggtgccagtgagctcatt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38997241 |
gacagaacatgttgttgttagtgaattcaaatggttaagtttttggggctgcaaggaggtgaggcaagtcccaacagaatatggtgccagtgagctcatt |
38997142 |
T |
|
| Q |
308 |
tccactgaattcaggatatggccaagcgtccc-nnnnnnnnnagtaagttagtagtagtatcagtatgaatattgtggttca |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38997141 |
tccactgaattcaggatatggccaagcgtcccttttttttttagtaaggtagtagtagtatcagtatgaatattgtggttca |
38997060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2694 times since January 2019
Visitors: 8577