View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4356-Insertion-13 (Length: 322)
Name: NF4356-Insertion-13
Description: NF4356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4356-Insertion-13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 9e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 146 - 311
Target Start/End: Original strand, 37725710 - 37725873
Alignment:
| Q |
146 |
tttcttgcacacaatatccaatgatgtcgcaatcatgtacttttctcctctcttttttgtgttgaaatagcttctcttacat---acctttctctaattc |
242 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
37725710 |
tttcttacacacaatatccaatgacgtcgcaatcatgtacttttctcctctcttttttgtgttgaaatagcttctcacacataccacctttctctaattc |
37725809 |
T |
|
| Q |
243 |
tctcaaccaaaacaaacactaactggccgaatcctttatctttggttattttgaaccaaagtcgctgtt |
311 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37725810 |
tctcaac-----caaacactaactggccgaatcctttatctttggttattttgaaccaaagtcgctgtt |
37725873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 8 - 100
Target Start/End: Original strand, 37725245 - 37725337
Alignment:
| Q |
8 |
ctaagagggtacaatcacccgtccttttcaaatattagacaacacgcgaccacattatcaagtgtaactgcgtgttcaaaggaattgaaacac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37725245 |
ctaagagggtacaatcacccgtccttttcaaatattagacaacacgtgaccacattatcaagtgtaactgcgtgttcaaaggaattgaaacac |
37725337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2129 times since January 2019
Visitors: 8677