View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4356-Insertion-15 (Length: 146)
Name: NF4356-Insertion-15
Description: NF4356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4356-Insertion-15 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 3e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 3e-68
Query Start/End: Original strand, 8 - 146
Target Start/End: Complemental strand, 49655216 - 49655078
Alignment:
Q |
8 |
ccgaccacctctcgaggtccaactcgtatcagattttttgttttcagccattctttcttctaaaacactataaacatataatacaccaccaaaacacaag |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49655216 |
ccgaccacctctcgaggtccaactcgtatcagattttttggttccagccattctttcttctaaaacactataaacatataatacaccaccaaaacacaag |
49655117 |
T |
|
Q |
108 |
gtttgaaacacacactaaaatcataacacatgattatgc |
146 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49655116 |
gtttgaaacacacactaaaatcataacacatgattatgc |
49655078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2708 times since January 2019
Visitors: 8577