View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4356-Insertion-16 (Length: 78)

Name: NF4356-Insertion-16
Description: NF4356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4356-Insertion-16
NF4356-Insertion-16
[»] chr5 (3 HSPs)
chr5 (7-77)||(31100059-31100129)
chr5 (7-77)||(31141222-31141292)
chr5 (7-64)||(31147309-31147367)


Alignment Details
Target: chr5 (Bit Score: 71; Significance: 8e-33; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 71; E-Value: 8e-33
Query Start/End: Original strand, 7 - 77
Target Start/End: Complemental strand, 31100129 - 31100059
Alignment:
7 atattcagatacgtatcaactttgaatactagaaatcatttacttcccaaaaagatggtatttgaatgcca 77  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31100129 atattcagatacgtatcaactttgaatactagaaatcatttacttcccaaaaagatggtatttgaatgcca 31100059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 71; E-Value: 8e-33
Query Start/End: Original strand, 7 - 77
Target Start/End: Original strand, 31141222 - 31141292
Alignment:
7 atattcagatacgtatcaactttgaatactagaaatcatttacttcccaaaaagatggtatttgaatgcca 77  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31141222 atattcagatacgtatcaactttgaatactagaaatcatttacttcccaaaaagatggtatttgaatgcca 31141292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 7 - 64
Target Start/End: Original strand, 31147309 - 31147367
Alignment:
7 atattcagatacgtatcaacttt-gaatactagaaatcatttacttcccaaaaagatgg 64  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
31147309 atattcagatacgtatcaacttttgaatactagaaatcatttacttcccaaaaagatgg 31147367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3527 times since January 2019
Visitors: 8698