View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4356-Insertion-16 (Length: 78)
Name: NF4356-Insertion-16
Description: NF4356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4356-Insertion-16 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 8e-33; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 8e-33
Query Start/End: Original strand, 7 - 77
Target Start/End: Complemental strand, 31100129 - 31100059
Alignment:
Q |
7 |
atattcagatacgtatcaactttgaatactagaaatcatttacttcccaaaaagatggtatttgaatgcca |
77 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31100129 |
atattcagatacgtatcaactttgaatactagaaatcatttacttcccaaaaagatggtatttgaatgcca |
31100059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 8e-33
Query Start/End: Original strand, 7 - 77
Target Start/End: Original strand, 31141222 - 31141292
Alignment:
Q |
7 |
atattcagatacgtatcaactttgaatactagaaatcatttacttcccaaaaagatggtatttgaatgcca |
77 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31141222 |
atattcagatacgtatcaactttgaatactagaaatcatttacttcccaaaaagatggtatttgaatgcca |
31141292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 7 - 64
Target Start/End: Original strand, 31147309 - 31147367
Alignment:
Q |
7 |
atattcagatacgtatcaacttt-gaatactagaaatcatttacttcccaaaaagatgg |
64 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
31147309 |
atattcagatacgtatcaacttttgaatactagaaatcatttacttcccaaaaagatgg |
31147367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3527 times since January 2019
Visitors: 8698