View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4356-Insertion-17 (Length: 43)
Name: NF4356-Insertion-17
Description: NF4356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4356-Insertion-17 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 36; Significance: 0.000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 43
Target Start/End: Complemental strand, 37248874 - 37248839
Alignment:
Q |
8 |
gtcatctcatatattttatgaacagtaccatgcata |
43 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
37248874 |
gtcatctcatatattttatgaacagtaccatgcata |
37248839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2960 times since January 2019
Visitors: 8641