View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4356-Insertion-18 (Length: 58)
Name: NF4356-Insertion-18
Description: NF4356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4356-Insertion-18 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 51; Significance: 4e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 4e-21
Query Start/End: Original strand, 8 - 58
Target Start/End: Complemental strand, 47895477 - 47895427
Alignment:
| Q |
8 |
cataattctttctctttcatctccagcattctctttacagaagaatccact |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47895477 |
cataattctttctctttcatctccagcattctctttacagaagaatccact |
47895427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 4e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 4e-21
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 31214069 - 31214119
Alignment:
| Q |
8 |
cataattctttctctttcatctccagcattctctttacagaagaatccact |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31214069 |
cataattctttctctttcatctccagcattctctttacagaagaatccact |
31214119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 4e-21
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 31219824 - 31219874
Alignment:
| Q |
8 |
cataattctttctctttcatctccagcattctctttacagaagaatccact |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31219824 |
cataattctttctctttcatctccagcattctctttacagaagaatccact |
31219874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 28; Significance: 0.0000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 28; E-Value: 0.0000002
Query Start/End: Original strand, 10 - 49
Target Start/End: Original strand, 4960704 - 4960743
Alignment:
| Q |
10 |
taattctttctctttcatctccagcattctctttacagaa |
49 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
4960704 |
taattctttctctttaatctccagcattttctttgcagaa |
4960743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2159 times since January 2019
Visitors: 8677