View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4356_high_4 (Length: 254)
Name: NF4356_high_4
Description: NF4356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4356_high_4 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 13 - 237
Target Start/End: Complemental strand, 30841504 - 30841280
Alignment:
Q |
13 |
aaaattatcatgttgtatctttttacatgtgtgcttctgaatatctaatttcgtactctctgtatctttctttcttgtggaaattagttggagttgacca |
112 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||| |
|
|
T |
30841504 |
aaaattatcatgttttatctttttacatgtgtgcttctgaatatctaatttcgtactctctgaatctttctttcttctggaaattagttggagttaacca |
30841405 |
T |
|
Q |
113 |
aaaagctggattgactgtagaatgtggagaagatatgttgaatacaatcatagcaataaaaatatctatccttataacattttcgagtctgattttgttc |
212 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||| |
|
|
T |
30841404 |
aaaagctggattgactgtagaatgtggagaagatatgttgaatacaatcatagcaataaaaatatctctccttataagattttcgagtcttattttgttc |
30841305 |
T |
|
Q |
213 |
tattgtcgccactaattgttgcaac |
237 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
30841304 |
tattgtcgccactaattgttgcaac |
30841280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3502 times since January 2019
Visitors: 8698