View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4356_high_5 (Length: 239)
Name: NF4356_high_5
Description: NF4356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4356_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 49655432 - 49655212
Alignment:
| Q |
1 |
tacaaatgagagtaaagtgtcatctctcaccattcaaattcaaaatttagacaaagtgaatttgaatggtgagaaatgacactttactctcttatctgta |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
49655432 |
tacagatgagagtaaagtgtcatctctcaccattcaaattcaaaatttagacaaagtgaatttgaatggtgagagatgacactttactctcttatgtgta |
49655333 |
T |
|
| Q |
101 |
aattacacctgtgagaatccattctcggtcccaactcaatcaaccactaacttgaaatttgagtacttacagttacatcacacctttcggagaactcttg |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49655332 |
aattacatctgtgagaatccattctcggtcccaactcaatcaaccactaacttgagatttgagtacttacagttacatcacaccttttggagaactcttg |
49655233 |
T |
|
| Q |
201 |
ttgtagtccagacatcccgac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
49655232 |
ttgtagtccagacatcccgac |
49655212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 8 - 124
Target Start/End: Original strand, 49655342 - 49655456
Alignment:
| Q |
8 |
gagagtaaagtgtcatctctcaccattcaaattcaaaatttagacaaagtgaatttgaatggtgagaaatgacactttactctcttatctgtaaattaca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | | | | |||||||||||||||||| |||||||||||||||| |||||||||| ||| |
|
|
| T |
49655342 |
gagagtaaagtgtcatctctcaccattcaaattcactttgtctaaattttgaatttgaatggtgagagatgacactttactctc--atctgtaaataaca |
49655439 |
T |
|
| Q |
108 |
cctgtgagaatccattc |
124 |
Q |
| |
|
| || ||| |||||||| |
|
|
| T |
49655440 |
cttgagaggatccattc |
49655456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3952 times since January 2019
Visitors: 8743