View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4356_high_8 (Length: 225)
Name: NF4356_high_8
Description: NF4356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4356_high_8 |
| |
|
[»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 8458688 - 8458913
Alignment:
Q |
1 |
atgctcttgattcactctctgtgcaggctcactggcccttcccctctgatcatgttatggaggtacata-tttttggccattagtgnnnnnnnaaataat |
99 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||| |
|
|
T |
8458688 |
atgctcttgattcactctctgtgcaggctcactggcccttcccctctgatcatgttatggaggtacatattttttggccgttagtgtttttttaaataat |
8458787 |
T |
|
Q |
100 |
aatgctttccagtccagagagaagtagttacatatgataacaataatttgtatgtgcatnnnnnnntttattgcttgtcagtcacaatcttaaaatttaa |
199 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
T |
8458788 |
aatgctttccagtccagagagaagtagttacatatgataccaagaatttgtatgtgcataaaaaattttattgcttgtcagtcaaaatcttaaaatttaa |
8458887 |
T |
|
Q |
200 |
taattttgtcgcttatacgttgtctt |
225 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
8458888 |
taattttgtcgcttatacgttgtctt |
8458913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2005 times since January 2019
Visitors: 6960