View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4356_low_4 (Length: 277)
Name: NF4356_low_4
Description: NF4356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4356_low_4 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 276
Target Start/End: Complemental strand, 10595703 - 10595443
Alignment:
Q |
16 |
tgtggtggtatagggtggttataattgctagcataaggccaaggttgttcataagggaagggtgatttggtcatttgaggaggaacaagttcaatgccag |
115 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| | |
|
|
T |
10595703 |
tgtggtggtatagggtggttataattgctagcataaggccaaggttgttcataagggaagggtgatttggtcatttgaggaggaacaggttccatgcttg |
10595604 |
T |
|
Q |
116 |
gatgatggtaatgagggaatggtatttggtttctttgaaatgggtatgagtccatgtttctgtatccaggaatcatgtttgtttggaaaggttaccaaga |
215 |
Q |
|
|
|||| || |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10595603 |
gatggtgataataagggaatggtatttggtttctttgaaatgggtatgagtccatgtttctgtatccaggaatcatgtttgtttggaaaggttaccaaga |
10595504 |
T |
|
Q |
216 |
acagacagaactagattttcactggctgatcttggaaagttattatagcacaaactctgca |
276 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10595503 |
acagacagaactagattttcactggctgatcttggaaagttattatagcacaaactctgca |
10595443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3401 times since January 2019
Visitors: 8687