View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4356_low_7 (Length: 239)
Name: NF4356_low_7
Description: NF4356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4356_low_7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 33451573 - 33451354
Alignment:
| Q |
19 |
agtaatagtgattgttatatcatgtcatatacaactataaaccaaaatgaatttcaatcaaattgaaacgcaaggtataatttaaacacaagaatgtcca |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33451573 |
agtaatagtaattgttatatcatgtcatatacaattataaaccaaaatgaatttcaatcaaattgaaacgcaaggtataatttaaacacaagaatgtcca |
33451474 |
T |
|
| Q |
119 |
gccgatcaaaatgcatgtaattcagcaattgtattcaaattttagcaataataatnnnnnnngacaaatacaacatgcaactttagataaccatggtcca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33451473 |
gccgatcaaaatgcatgtaattcagcaattgtattcaaaatttagcaataataat-caaaaagacaaatacaacatgcaactttagataaccatggtcca |
33451375 |
T |
|
| Q |
219 |
tcaatattacatataattttc |
239 |
Q |
| |
|
|| |||||||| ||||||||| |
|
|
| T |
33451374 |
tccatattacagataattttc |
33451354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3627 times since January 2019
Visitors: 8709