View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4377-Insertion-8 (Length: 259)
Name: NF4377-Insertion-8
Description: NF4377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4377-Insertion-8 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 8 - 259
Target Start/End: Complemental strand, 26599486 - 26599235
Alignment:
| Q |
8 |
aaagtcggttgagttagtagtgagactgaggctatgatcattgtgagggttttggctattacttgtttgttggaaatggaaattattgttgttgacaaaa |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26599486 |
aaagtcagttgagttagtagtgagactgaggctatgatcattgtgagggttttggctattacttgtttgttggaaatggaaattattgttgttgacaaaa |
26599387 |
T |
|
| Q |
108 |
ttggtttctggtagagaagtttggttactgttttcaccatataaagcttcaagttgacgaaaaaacctgtaatgcttaccatcatgccttcctgctttac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26599386 |
ttggtttctggtagagaagtttggttactgttttcaccatataaagcttcaagttgacgaaaaaacctgtaatgcttaccatcatgccttcctgctttac |
26599287 |
T |
|
| Q |
208 |
cttcttttgtcttcttgtaatatttgtacagattctcaaatttttctctgca |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26599286 |
cttcttttgtcttcttgtaatatttgtacagattctcaaatttttctctgca |
26599235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 180 - 259
Target Start/End: Original strand, 41605294 - 41605373
Alignment:
| Q |
180 |
tgcttaccatcatgccttcctgctttaccttcttttgtcttcttgtaatatttgtacagattctcaaatttttctctgca |
259 |
Q |
| |
|
||||||||||| || || | ||||||||||| || |||||||||||||| ||||||| ||||||||| |||||| |||| |
|
|
| T |
41605294 |
tgcttaccatcttgtctactagctttaccttccttggtcttcttgtaatacttgtacaaattctcaaacttttctttgca |
41605373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1212 times since January 2019
Visitors: 5951