View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4377_high_1_N (Length: 427)
Name: NF4377_high_1_N
Description: NF4377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4377_high_1_N |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 169 - 398
Target Start/End: Original strand, 34899746 - 34899975
Alignment:
| Q |
169 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899746 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
34899845 |
T |
|
| Q |
269 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899846 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
34899945 |
T |
|
| Q |
369 |
gtttggtagtttcaactttcaagttgagat |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34899946 |
gtttggtagtttcaactttcaagttgagat |
34899975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 79; Significance: 9e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 29465267 - 29465158
Alignment:
| Q |
1 |
catttgggattccttgtcttccatgtccccgtggccagcccttggaggtatgcttttccaatttccgttgatgaaaatggcatcctaactgttacagcta |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
29465267 |
catttgggactccttgtcttccatgtccccgtggccagcccttggaggtatgcttttcca-------ttgatgaaaatggcatcctaactgttactgcta |
29465175 |
T |
|
| Q |
101 |
aggaaatatccactgac |
117 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
29465174 |
aggaaatatctactgac |
29465158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 2e-22; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 8666834 - 8666729
Alignment:
| Q |
1 |
catttgggattccttgtcttccatgtccccgtggccagcccttggaggtatgcttttccaatttccgttgatgaaaatggcatcctaactgttacagcta |
100 |
Q |
| |
|
|||||||| ||| |||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||| ||||| |||||||| |||| |
|
|
| T |
8666834 |
catttgggcttcgttgtcttccaggtccccgtggccagcccttggaggtatgcttttcaa-------ttgatgaaaatggtatcctgactgttactgcta |
8666742 |
T |
|
| Q |
101 |
aggaaatatccac |
113 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8666741 |
gggaaatatccac |
8666729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 25 - 110
Target Start/End: Original strand, 10495148 - 10495226
Alignment:
| Q |
25 |
gtccccgtggccagcccttggaggtatgcttttccaatttccgttgatgaaaatggcatcctaactgttacagctaaggaaatatc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
10495148 |
gtcctcgtggccagcccttggaggtatgcttttcca-------ttgatgaaaatggcatcctgactgttactgctaaggatatatc |
10495226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 13334136 - 13334220
Alignment:
| Q |
19 |
ttccatgtccccgtggccagcccttggaggtatgcttttccaatttccgttgatgaaaatggcatcctaactgttacagctaaggaaatatc |
110 |
Q |
| |
|
||||| |||| ||||| ||||||||||||||||||||||||| ||||||||||||||||||| || ||||| |||||||| ||||| |
|
|
| T |
13334136 |
ttccaggtccgcgtggtcagcccttggaggtatgcttttcca-------ttgatgaaaatggcatcctgacggttactgctaaggatatatc |
13334220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 13 - 60
Target Start/End: Complemental strand, 8653850 - 8653803
Alignment:
| Q |
13 |
cttgtcttccatgtccccgtggccagcccttggaggtatgcttttcca |
60 |
Q |
| |
|
|||| |||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8653850 |
cttgccttccaggtccccgtggtcagcccttggaggtatgcttttcca |
8653803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 9336644 - 9336746
Alignment:
| Q |
1 |
catttgggattccttgtcttccatgtccccgtggccagcccttggaggtatgcttttccaatttccgttgatgaaaatggcatcctaactgttacagcta |
100 |
Q |
| |
|
||||| || ||| |||||||||| |||||||||||| |||||||||| |||||||| | |||||||||||||||||||||||||||| |||| |
|
|
| T |
9336644 |
catttcggcttcattgtcttccagctccccgtggccatcccttggaggcctgcttttcga-------ttgatgaaaatggcatcctaactgttactgcta |
9336736 |
T |
|
| Q |
101 |
aggaaatatc |
110 |
Q |
| |
|
||||||||| |
|
|
| T |
9336737 |
gggaaatatc |
9336746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6243 times since January 2019
Visitors: 5127