View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4377_high_7 (Length: 302)
Name: NF4377_high_7
Description: NF4377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4377_high_7 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 186 - 302
Target Start/End: Complemental strand, 33253464 - 33253348
Alignment:
| Q |
186 |
tcactaagaaaaacacacaaattattcacaaagcgagcacactaatgttaattaatccatgtccatactgttatgtcatggtcataataacgtgagattt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33253464 |
tcactaagaaaaacacacaaattattcacaaagcgagcacactgctgttaattaatccatgtccatactgttatgtcatagtcataataacgtgagattt |
33253365 |
T |
|
| Q |
286 |
tacattagcataattaa |
302 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33253364 |
tacattagcataattaa |
33253348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 5 - 89
Target Start/End: Original strand, 42045685 - 42045769
Alignment:
| Q |
5 |
gagtgagatgaagtatagttaggagggtgagaattggttcgggttggagattcaagatctggcatgaaggaaacttgatcatcat |
89 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42045685 |
gagtgatatgaagtatagttaggagggtgagaattggttcgggttggagattcaagatctggcatgaaggaaacttgatcatcat |
42045769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 88 - 177
Target Start/End: Original strand, 33253347 - 33253436
Alignment:
| Q |
88 |
attaattatgctaatgtaaaatctcacgttattatgaccatgacataacagtatggacatggattaattaacattagtgtgctcgctttg |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33253347 |
attaattatgctaatgtaaaatctcacgttattatgactatgacataacagtatggacatggattaattaacagcagtgtgctcgctttg |
33253436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1294 times since January 2019
Visitors: 5993