View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4383_low_3 (Length: 514)
Name: NF4383_low_3
Description: NF4383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4383_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 2e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 19 - 182
Target Start/End: Original strand, 30888859 - 30889022
Alignment:
| Q |
19 |
gtgtcgtgctaacttgtgttgtgtatgatactacaaaatcactgcaggtggcatgagatacatcaaacaagaattcaacttagaaactgatccaacgctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30888859 |
gtgtcgtgctaacttgtgttgtgtatgatactacaaaatcactgcaggtggcatgagatacatcaaacaagaattcaacttagaaactgatccaacgctt |
30888958 |
T |
|
| Q |
119 |
gaaggactaattgtgtccatgtcatttctcactggaacatttgtaacaatattctccggcacag |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30888959 |
gaaggactaattgtgtccatgtcatttctcactggaacatttgtaacaatattctccggcacag |
30889022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3433 times since January 2019
Visitors: 7878