View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4390_low_5 (Length: 319)
Name: NF4390_low_5
Description: NF4390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4390_low_5 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 3854067 - 3854276
Alignment:
Q |
1 |
tgttgtgatgttttgacagatgaattgataggactgtgctggagccttcagatggccagtgatagtaaggtgtttacttgaattggatgcttgtgaaatt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3854067 |
tgttgtgatgttttgacagatgaattgataggattgtgctggagccttcagatggccagtgatagtaaggtgtttacttgaattggatgcttgtgaaatt |
3854166 |
T |
|
Q |
101 |
cgctcagttcgctgctatcattatcaattttttctgccttcggactttgtaatagaggttggtcctctcaatatagagatgtgattttttctgaaatcct |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
3854167 |
cgctcagttcgctgctatcattatcaattttttctgccttcggactttgtaatagaggttggtcctctcaatatagagatgtgatttttgctgaaatcct |
3854266 |
T |
|
Q |
201 |
taacgtgatt |
210 |
Q |
|
|
||| |||||| |
|
|
T |
3854267 |
taatgtgatt |
3854276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 179 - 305
Target Start/End: Original strand, 3854269 - 3854395
Alignment:
Q |
179 |
atgtgattttttctgaaatccttaacgtgattaatattgtatggtacagctgcaacctacagaggtttgatggtaaaaccatgtcttggcaaacagcagc |
278 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3854269 |
atgtgattttttctgaaatccttaacgtgattaatattgtatggtacagctgcaatctacagaggtttgatggtaaaaccatgtcttggcaaacagcagc |
3854368 |
T |
|
Q |
279 |
cagcaagattatctcgactgttttctt |
305 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
3854369 |
cagcaagattatctcgactgttttctt |
3854395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1385 times since January 2019
Visitors: 6038