View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4407-Insertion-10 (Length: 137)
Name: NF4407-Insertion-10
Description: NF4407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4407-Insertion-10 |
| |
|
[»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 2e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 2e-65
Query Start/End: Original strand, 8 - 137
Target Start/End: Complemental strand, 39475670 - 39475541
Alignment:
Q |
8 |
atattattgtggtagcagaatctcttattgtgtgagtgaatccataattctgtccttttcttagttctgatcactcaaaatacttccaatatattcctta |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
39475670 |
atattattgtggtagcagaatctcttattgtgtgagtgaatccataattctgtccttttcttagttctgatcactcaaaatactttcaatatattcctta |
39475571 |
T |
|
Q |
108 |
aactatagttgttgaattcaagatctccct |
137 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
39475570 |
aactatagttgttgaattcaagatctccct |
39475541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1803 times since January 2019
Visitors: 8634