View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4407-Insertion-8 (Length: 42)
Name: NF4407-Insertion-8
Description: NF4407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4407-Insertion-8 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 35; Significance: 0.00000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 42
Target Start/End: Original strand, 34079194 - 34079228
Alignment:
| Q |
8 |
ggtaggatatcatgcgcatgatgattgttttcaag |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34079194 |
ggtaggatatcatgcgcatgatgattgttttcaag |
34079228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2001 times since January 2019
Visitors: 8647