View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4409-Insertion-5 (Length: 111)
Name: NF4409-Insertion-5
Description: NF4409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4409-Insertion-5 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 8 - 111
Target Start/End: Complemental strand, 9820464 - 9820361
Alignment:
| Q |
8 |
attactttactgtgagttaagttgatctttgtggtagaaatatgtctgattctaagatcattgttgcattttatctttgcttttccagtgactgatggac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9820464 |
attactttactgtgagttaagttgatctttttggtagaaatatgtctgattctaagatcattgttgcattttatctttgcttttccagtgactgatggcc |
9820365 |
T |
|
| Q |
108 |
ctca |
111 |
Q |
| |
|
|||| |
|
|
| T |
9820364 |
ctca |
9820361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 71; Significance: 1e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 8 - 110
Target Start/End: Complemental strand, 38874096 - 38873994
Alignment:
| Q |
8 |
attactttactgtgagttaagttgatctttgtggtagaaatatgtctgattctaagatcattgttgcattttatctttgcttttccagtgactgatggac |
107 |
Q |
| |
|
||||||| | |||||||| ||||||||||||||||||||||| || ||||||| |||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
38874096 |
attacttcattgtgagttgagttgatctttgtggtagaaatacgtatgattctgagatcattgttgcattttatctttacttttccagtgactgatggcc |
38873997 |
T |
|
| Q |
108 |
ctc |
110 |
Q |
| |
|
||| |
|
|
| T |
38873996 |
ctc |
38873994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 54 - 105
Target Start/End: Original strand, 38694151 - 38694203
Alignment:
| Q |
54 |
tgattctaagatcattgttgcattttatc-tttgcttttccagtgactgatgg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| | ||||||||||||||||| |
|
|
| T |
38694151 |
tgattctaagatcattgttgcattttatcgttttcctttccagtgactgatgg |
38694203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2235 times since January 2019
Visitors: 8690