View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4409-Insertion-6 (Length: 59)
Name: NF4409-Insertion-6
Description: NF4409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4409-Insertion-6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 41; Significance: 0.000000000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.000000000000004
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 38053545 - 38053505
Alignment:
| Q |
19 |
actaaagatgatatgctaggtccatcatccttccctcgttc |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38053545 |
actaaagatgatatgctaggtccatcatccttccctcgttc |
38053505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3635 times since January 2019
Visitors: 8709