View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4409_high_14 (Length: 233)

Name: NF4409_high_14
Description: NF4409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4409_high_14
NF4409_high_14
[»] chr7 (1 HSPs)
chr7 (57-115)||(4094614-4094669)


Alignment Details
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 115
Target Start/End: Complemental strand, 4094669 - 4094614
Alignment:
57 ctagttctgttttattatcatcttttgaacgttgtggaaatataatatcaccctcgttc 115  Q
    |||||||||||||||||||   ||||||||||||| |||||||||||| ||||||||||    
4094669 ctagttctgttttattatc---ttttgaacgttgttgaaatataatataaccctcgttc 4094614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3818 times since January 2019
Visitors: 8728