View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4409_low_10 (Length: 332)
Name: NF4409_low_10
Description: NF4409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4409_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 99 - 271
Target Start/End: Original strand, 8315742 - 8315913
Alignment:
| Q |
99 |
tggggttaacacgttttttagataaaaatggcccaaattggnnnnnnnnnnnnnacaaaatgaatttggtaaaaacaaaagagtctcaagtttgaaccct |
198 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8315742 |
tggggttaacccgttttttagataaaaatggcccaaattggttttttagtttttacaaaatgaatttggcaaaaacaaaagagtctcaagtttgaaccct |
8315841 |
T |
|
| Q |
199 |
gcggcgtcacagtctcaaattctgaacgagatatgaccgatcaggtattattgacttgtcaatcattctatag |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8315842 |
gcggcgtcacagtctcaaattctgaacgaga-atgaccgatcaggtattattgacttgtcaatcattctatag |
8315913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 13 - 57
Target Start/End: Original strand, 8315643 - 8315687
Alignment:
| Q |
13 |
aatattattttcaatctggattagtaaatttggaggggtataatt |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8315643 |
aatattattttcaatctggattagtaaatttggaggggtataatt |
8315687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3995 times since January 2019
Visitors: 8743