View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4409_low_9 (Length: 333)
Name: NF4409_low_9
Description: NF4409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4409_low_9 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 145 - 304
Target Start/End: Original strand, 508403 - 508559
Alignment:
Q |
145 |
ggcacacccctcctaaataatttgataatttcagattcacacgagacaattaagttgcaaagaaaatagttgtattt-aatgataaattaatgtatgtgt |
243 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
508403 |
ggcacacccctcctaaataatttgataatttcagattcacacgagacaattaacttgcaaagaaaatagttgtatttaaatgata----aatgtatgtgt |
508498 |
T |
|
Q |
244 |
gctggctagcaatatatgcaatgtacgtatatatctaggactaagaaaattgcgtctatct |
304 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
508499 |
gctggctagcaatatatgcaatgtacgtatatatctaggactaagaaaattgcgtctatct |
508559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 46 - 97
Target Start/End: Original strand, 508231 - 508282
Alignment:
Q |
46 |
catctttgatgaaaacgttttagaccttggagacaaaggtagattacatgtc |
97 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
508231 |
catctttgatgaaaacgttttagaccttggagacaaaggtagattacatgtc |
508282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2672 times since January 2019
Visitors: 8577