View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410-Insertion-5 (Length: 227)
Name: NF4410-Insertion-5
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4410-Insertion-5 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 115 - 227
Target Start/End: Complemental strand, 29284859 - 29284747
Alignment:
| Q |
115 |
gttgcaattgtgcgatttaaaccttatttttacaccttttctcatttactagcctctcgtgcacattttgactaagaaaatagacttgtccattatttcc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29284859 |
gttgcaattgtgcgatttaaaccttatttttaccccttttctcatttactagcctctcgtgcacattttgactaagaaaatagacatgtccattatttcc |
29284760 |
T |
|
| Q |
215 |
aggtgcttgatta |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29284759 |
aggtgcttgatta |
29284747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 29287211 - 29287105
Alignment:
| Q |
8 |
caatgtgttatcaaagttcatatatgaaacaatacttaattttatgaaaattttcaaacttaaatgcagtagcttaaatttgtcccttgttcaatttaga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29287211 |
caatgtgttatcaaagttcatatatgaaacaatatttaattttatgaaaattttcaaacttaaatgcagtagcttaaatttgtcccttgttcaatttaga |
29287112 |
T |
|
| Q |
108 |
ttctcta |
114 |
Q |
| |
|
||||||| |
|
|
| T |
29287111 |
ttctcta |
29287105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3677 times since January 2019
Visitors: 8709