View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410-Insertion-6 (Length: 203)
Name: NF4410-Insertion-6
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF4410-Insertion-6 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 8 - 202
Target Start/End: Original strand, 13069795 - 13069989
Alignment:
Q |
8 |
ggtactagtaaaggtctattggggagatgctcgtgagaaattatgtgaagcaattgaacaagtacctcttgatggtcttaccatggggaatagaggtctt |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13069795 |
ggtactagtaaaggtctattggggagatgctcgtgagaaattatgtgaagcaattgaacaagtacctcttgatggtcttaccatggggaatagaggtctt |
13069894 |
T |
|
Q |
108 |
ggcacccttagaaggtagatataccaccttaacccgaaattgagagtttcannnnnnnnaatgatatttcattgaatattttactatattgtttt |
202 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
13069895 |
ggcacccttagaaggtagatataccaccttaacccgaaattgagagtttcattttttttaatgatatttcattgaatattttactatattgtttt |
13069989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3294 times since January 2019
Visitors: 8679