View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410_high_21 (Length: 250)
Name: NF4410_high_21
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4410_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 2302672 - 2302433
Alignment:
| Q |
1 |
cttatcttaccttcattatgattgcaagccagcaattattcacagagatgttactaccaaaaatgttctcttgaactcagaaatggaagcttgtctttct |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2302672 |
cttatcttaccttcattatgattgcgagccagcaattattcacagagatgtgactaccaaaaatgttctcttgaactcagaaatggaagcttgtctttct |
2302573 |
T |
|
| Q |
101 |
gattttggcatagctagacttcgaaattctagttcgtcgaaccggacagtacttgcaggcacatatggatatattgcaccaggtgatcttttttatatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2302572 |
gattttggcatagctagacttcgaaattctagttcgtcgaaccggacagtccttgcaggcacatatggatatattgcaccaggtgatcttttttatatgt |
2302473 |
T |
|
| Q |
201 |
taattgttggaaattccttcttaaatgtagtctgcctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2302472 |
taattgttggaaattccttcttaaatgtagtctgcctttg |
2302433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4014 times since January 2019
Visitors: 8743