View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4410_high_23 (Length: 247)
Name: NF4410_high_23
Description: NF4410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4410_high_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 14 - 177
Target Start/End: Complemental strand, 43516343 - 43516180
Alignment:
| Q |
14 |
ctgtgtatcttcaccataattgaatagactaatccctcaaacggttagaattgcaatgtgtgacaaagctcactcacaaaatatttgattggtgttagat |
113 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43516343 |
ctgtgtatcttcaccacaattgaatagactaatccatcgaacggttagaattgcaatgtgtaacaaagctcactcacaaaatatttgattggtgttagat |
43516244 |
T |
|
| Q |
114 |
ttgaaccatgacttccgattaagttgcaagagtttgagtcaataaaagggtgcatggaaggttt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43516243 |
ttgaaccatgacttccgattaagttgcaagagtttgagtcaataaaagggtgcatgcaaggttt |
43516180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4259 times since January 2019
Visitors: 8757